Review



addgene pcdna3 ha arf1 q71l  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc addgene pcdna3 ha arf1 q71l
    Addgene Pcdna3 Ha Arf1 Q71l, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+pcdna3+flag+ha/FLAG%2EPKCzeta%2EK%2FW+(Plasmid+%2310800)/pm41600775-52-9-9
    Average 93 stars, based on 3 article reviews
    addgene pcdna3 ha arf1 q71l - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Salmonella Typhimurium effector SseI regulates host peroxisomal dynamics to acquire lysosomal cholesterol.
    Article Snippet: Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models HeLa cells (H. sapiens) ATCC CCL-2 LOT: 70056809 Monocytes derived macrophages (H. sapiens) Blood bank at the Transfusion Medicine - King Georges’ Medical University Salmonella Typhimurium Kind gift from Prof. Michael Hensel ATCC, 14028 C57BL6/J (M. musculus) Central Animal Facility, IISc Bangalore, India. .. Recombinant DNA pLJC5-3XMyc-EGFP-PEX26 Addgene 139059 pcDNA3 flag HA: SseI This study Vector backbone from #9021, Addgene pcDNA3 flag HA: ARF1 This study Vector backbone from #9021, Addgene pFPV-mCherry Addgene 20956 pET23A His tagged SseI This study N/A pQE60 myc::sseI This study N/A pQE60 sseI::myc This study N/A SseI, Syt7, and ARF1 (along with mutants) were synthesized commercially GenScript Antibodies Rabbit Anti-LAMP1 Cell Signalling Technology (CST) D401S Anti-FLAG CST 8146 Anti-myc CST 2276 Anti-Pex14 ABclonal A7336 Anti-ESYT1 ABclonal A15410 Anti-ABCD1 Proteintech 60153-1-Ig Anti-pex5 Proteintech 12545-1-AP Anti-ARF1 Proteintech 10790-1-AP Anti-GAPDH Invitrogen T0004 Anti-HA CiteAb 2367 Anti-SYT7 Novus Biologicals NBP2-22420 PIP2 antibody Novus Biologicals NBP2-76433 Goat anti-mouse IgG Alexa fluor 594 CiteAb A-11032 Goat anti-Rabbit IgG Alexa Fluor 488 CiteAb A-11034 Goat anti-rabbit IgG Cy5 Invitrogen A10523 Control Mouse immunoglobulin Invitrogen 500-M00-1MG Control rabbit immunoglobulin PeproTech 500-P00-500μg horseradish peroxidase CST 7074P2 Oligonucleotides and other sequence-based reagents ARF1 Santa Cruz SC-105086 Synaptotagmin VII (SYT7) Santa Cruz SC-41320 E-Syt1 Santa Cruz SC-95714 16 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on D ecem ber 25, 2024 from IP 2402:800:6343:b0f8:400f:1124:9738:8c7d. .. Reagent/Resource Reference or Source Identifier or Catalog Number NPC1 Santa Cruz SC-41588 ABCD1 Santa Cruz SC-41143 On-Target plusTM Control Pool Dharmacon DM D-001810-10-20 RT Primers PEX11B FWD CTTCAGTGCTCAGAGCCAAGCC PEX11B REV GCATGGCCAAGAAGAGAGCAA PEX14 FWD CAGAAAGATGGCGTCCTCGG PEX14 REV TCATCTGTCAGCCCTTTCTTCT PEX19 FWD CCCCCACAGACAGTGAAACC PEX19 REV GTTGAGGCCAGGAGGCATCTC ABCD1 FWD GCCCTCCCTGTGGAAATACC ABCD1 REV AGCTTCTCGAACTTCCAGCC ARF1 FWD GTTTGCTGTGAAGACGGTGTC ARF1 REV AGAGGATCGTGGTCTTCCCT GAPDH FWD TCGGAGTCAACGGATTTGGT GAPDH REV TTCCCGTTCTCAGCCTTGAC ACBD5::FWD HU CTGGAAACGCTGACTGCTTTGC

    Synthesized:

    Article Title: Salmonella Typhimurium effector SseI regulates host peroxisomal dynamics to acquire lysosomal cholesterol.
    Article Snippet: Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models HeLa cells (H. sapiens) ATCC CCL-2 LOT: 70056809 Monocytes derived macrophages (H. sapiens) Blood bank at the Transfusion Medicine - King Georges’ Medical University Salmonella Typhimurium Kind gift from Prof. Michael Hensel ATCC, 14028 C57BL6/J (M. musculus) Central Animal Facility, IISc Bangalore, India. .. Recombinant DNA pLJC5-3XMyc-EGFP-PEX26 Addgene 139059 pcDNA3 flag HA: SseI This study Vector backbone from #9021, Addgene pcDNA3 flag HA: ARF1 This study Vector backbone from #9021, Addgene pFPV-mCherry Addgene 20956 pET23A His tagged SseI This study N/A pQE60 myc::sseI This study N/A pQE60 sseI::myc This study N/A SseI, Syt7, and ARF1 (along with mutants) were synthesized commercially GenScript Antibodies Rabbit Anti-LAMP1 Cell Signalling Technology (CST) D401S Anti-FLAG CST 8146 Anti-myc CST 2276 Anti-Pex14 ABclonal A7336 Anti-ESYT1 ABclonal A15410 Anti-ABCD1 Proteintech 60153-1-Ig Anti-pex5 Proteintech 12545-1-AP Anti-ARF1 Proteintech 10790-1-AP Anti-GAPDH Invitrogen T0004 Anti-HA CiteAb 2367 Anti-SYT7 Novus Biologicals NBP2-22420 PIP2 antibody Novus Biologicals NBP2-76433 Goat anti-mouse IgG Alexa fluor 594 CiteAb A-11032 Goat anti-Rabbit IgG Alexa Fluor 488 CiteAb A-11034 Goat anti-rabbit IgG Cy5 Invitrogen A10523 Control Mouse immunoglobulin Invitrogen 500-M00-1MG Control rabbit immunoglobulin PeproTech 500-P00-500μg horseradish peroxidase CST 7074P2 Oligonucleotides and other sequence-based reagents ARF1 Santa Cruz SC-105086 Synaptotagmin VII (SYT7) Santa Cruz SC-41320 E-Syt1 Santa Cruz SC-95714 16 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on D ecem ber 25, 2024 from IP 2402:800:6343:b0f8:400f:1124:9738:8c7d. .. Reagent/Resource Reference or Source Identifier or Catalog Number NPC1 Santa Cruz SC-41588 ABCD1 Santa Cruz SC-41143 On-Target plusTM Control Pool Dharmacon DM D-001810-10-20 RT Primers PEX11B FWD CTTCAGTGCTCAGAGCCAAGCC PEX11B REV GCATGGCCAAGAAGAGAGCAA PEX14 FWD CAGAAAGATGGCGTCCTCGG PEX14 REV TCATCTGTCAGCCCTTTCTTCT PEX19 FWD CCCCCACAGACAGTGAAACC PEX19 REV GTTGAGGCCAGGAGGCATCTC ABCD1 FWD GCCCTCCCTGTGGAAATACC ABCD1 REV AGCTTCTCGAACTTCCAGCC ARF1 FWD GTTTGCTGTGAAGACGGTGTC ARF1 REV AGAGGATCGTGGTCTTCCCT GAPDH FWD TCGGAGTCAACGGATTTGGT GAPDH REV TTCCCGTTCTCAGCCTTGAC ACBD5::FWD HU CTGGAAACGCTGACTGCTTTGC

    Control:

    Article Title: Salmonella Typhimurium effector SseI regulates host peroxisomal dynamics to acquire lysosomal cholesterol.
    Article Snippet: Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models HeLa cells (H. sapiens) ATCC CCL-2 LOT: 70056809 Monocytes derived macrophages (H. sapiens) Blood bank at the Transfusion Medicine - King Georges’ Medical University Salmonella Typhimurium Kind gift from Prof. Michael Hensel ATCC, 14028 C57BL6/J (M. musculus) Central Animal Facility, IISc Bangalore, India. .. Recombinant DNA pLJC5-3XMyc-EGFP-PEX26 Addgene 139059 pcDNA3 flag HA: SseI This study Vector backbone from #9021, Addgene pcDNA3 flag HA: ARF1 This study Vector backbone from #9021, Addgene pFPV-mCherry Addgene 20956 pET23A His tagged SseI This study N/A pQE60 myc::sseI This study N/A pQE60 sseI::myc This study N/A SseI, Syt7, and ARF1 (along with mutants) were synthesized commercially GenScript Antibodies Rabbit Anti-LAMP1 Cell Signalling Technology (CST) D401S Anti-FLAG CST 8146 Anti-myc CST 2276 Anti-Pex14 ABclonal A7336 Anti-ESYT1 ABclonal A15410 Anti-ABCD1 Proteintech 60153-1-Ig Anti-pex5 Proteintech 12545-1-AP Anti-ARF1 Proteintech 10790-1-AP Anti-GAPDH Invitrogen T0004 Anti-HA CiteAb 2367 Anti-SYT7 Novus Biologicals NBP2-22420 PIP2 antibody Novus Biologicals NBP2-76433 Goat anti-mouse IgG Alexa fluor 594 CiteAb A-11032 Goat anti-Rabbit IgG Alexa Fluor 488 CiteAb A-11034 Goat anti-rabbit IgG Cy5 Invitrogen A10523 Control Mouse immunoglobulin Invitrogen 500-M00-1MG Control rabbit immunoglobulin PeproTech 500-P00-500μg horseradish peroxidase CST 7074P2 Oligonucleotides and other sequence-based reagents ARF1 Santa Cruz SC-105086 Synaptotagmin VII (SYT7) Santa Cruz SC-41320 E-Syt1 Santa Cruz SC-95714 16 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on D ecem ber 25, 2024 from IP 2402:800:6343:b0f8:400f:1124:9738:8c7d. .. Reagent/Resource Reference or Source Identifier or Catalog Number NPC1 Santa Cruz SC-41588 ABCD1 Santa Cruz SC-41143 On-Target plusTM Control Pool Dharmacon DM D-001810-10-20 RT Primers PEX11B FWD CTTCAGTGCTCAGAGCCAAGCC PEX11B REV GCATGGCCAAGAAGAGAGCAA PEX14 FWD CAGAAAGATGGCGTCCTCGG PEX14 REV TCATCTGTCAGCCCTTTCTTCT PEX19 FWD CCCCCACAGACAGTGAAACC PEX19 REV GTTGAGGCCAGGAGGCATCTC ABCD1 FWD GCCCTCCCTGTGGAAATACC ABCD1 REV AGCTTCTCGAACTTCCAGCC ARF1 FWD GTTTGCTGTGAAGACGGTGTC ARF1 REV AGAGGATCGTGGTCTTCCCT GAPDH FWD TCGGAGTCAACGGATTTGGT GAPDH REV TTCCCGTTCTCAGCCTTGAC ACBD5::FWD HU CTGGAAACGCTGACTGCTTTGC

    Sequencing:

    Article Title: Salmonella Typhimurium effector SseI regulates host peroxisomal dynamics to acquire lysosomal cholesterol.
    Article Snippet: Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models HeLa cells (H. sapiens) ATCC CCL-2 LOT: 70056809 Monocytes derived macrophages (H. sapiens) Blood bank at the Transfusion Medicine - King Georges’ Medical University Salmonella Typhimurium Kind gift from Prof. Michael Hensel ATCC, 14028 C57BL6/J (M. musculus) Central Animal Facility, IISc Bangalore, India. .. Recombinant DNA pLJC5-3XMyc-EGFP-PEX26 Addgene 139059 pcDNA3 flag HA: SseI This study Vector backbone from #9021, Addgene pcDNA3 flag HA: ARF1 This study Vector backbone from #9021, Addgene pFPV-mCherry Addgene 20956 pET23A His tagged SseI This study N/A pQE60 myc::sseI This study N/A pQE60 sseI::myc This study N/A SseI, Syt7, and ARF1 (along with mutants) were synthesized commercially GenScript Antibodies Rabbit Anti-LAMP1 Cell Signalling Technology (CST) D401S Anti-FLAG CST 8146 Anti-myc CST 2276 Anti-Pex14 ABclonal A7336 Anti-ESYT1 ABclonal A15410 Anti-ABCD1 Proteintech 60153-1-Ig Anti-pex5 Proteintech 12545-1-AP Anti-ARF1 Proteintech 10790-1-AP Anti-GAPDH Invitrogen T0004 Anti-HA CiteAb 2367 Anti-SYT7 Novus Biologicals NBP2-22420 PIP2 antibody Novus Biologicals NBP2-76433 Goat anti-mouse IgG Alexa fluor 594 CiteAb A-11032 Goat anti-Rabbit IgG Alexa Fluor 488 CiteAb A-11034 Goat anti-rabbit IgG Cy5 Invitrogen A10523 Control Mouse immunoglobulin Invitrogen 500-M00-1MG Control rabbit immunoglobulin PeproTech 500-P00-500μg horseradish peroxidase CST 7074P2 Oligonucleotides and other sequence-based reagents ARF1 Santa Cruz SC-105086 Synaptotagmin VII (SYT7) Santa Cruz SC-41320 E-Syt1 Santa Cruz SC-95714 16 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on D ecem ber 25, 2024 from IP 2402:800:6343:b0f8:400f:1124:9738:8c7d. .. Reagent/Resource Reference or Source Identifier or Catalog Number NPC1 Santa Cruz SC-41588 ABCD1 Santa Cruz SC-41143 On-Target plusTM Control Pool Dharmacon DM D-001810-10-20 RT Primers PEX11B FWD CTTCAGTGCTCAGAGCCAAGCC PEX11B REV GCATGGCCAAGAAGAGAGCAA PEX14 FWD CAGAAAGATGGCGTCCTCGG PEX14 REV TCATCTGTCAGCCCTTTCTTCT PEX19 FWD CCCCCACAGACAGTGAAACC PEX19 REV GTTGAGGCCAGGAGGCATCTC ABCD1 FWD GCCCTCCCTGTGGAAATACC ABCD1 REV AGCTTCTCGAACTTCCAGCC ARF1 FWD GTTTGCTGTGAAGACGGTGTC ARF1 REV AGAGGATCGTGGTCTTCCCT GAPDH FWD TCGGAGTCAACGGATTTGGT GAPDH REV TTCCCGTTCTCAGCCTTGAC ACBD5::FWD HU CTGGAAACGCTGACTGCTTTGC



    Similar Products

    93
    Addgene inc addgene pcdna3 ha arf1 q71l
    Addgene Pcdna3 Ha Arf1 Q71l, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+pcdna3+flag+ha/FLAG%2EPKCzeta%2EK%2FW+(Plasmid+%2310800)/pm41600775-52-9-9
    Average 93 stars, based on 1 article reviews
    addgene pcdna3 ha arf1 q71l - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc addgene plasmid
    Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+pcdna3+flag+ha/pcDNA3-FLAG-HA-CAD+(Plasmid+%2346238)/pmc12588189-107-6-6
    Average 93 stars, based on 1 article reviews
    addgene plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    95
    Addgene inc n a recombinant dna pcdna3 1 addgene 52535 plix 402 addgene 55169 pgex 4t1 addgene 2876
    N A Recombinant Dna Pcdna3 1 Addgene 52535 Plix 402 Addgene 55169 Pgex 4t1 Addgene 2876, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+pcdna3+flag+ha/FLAG-HA-pcDNA3%2E1-+(Plasmid+%2352535)/pm39817906-224-178-182
    Average 95 stars, based on 1 article reviews
    n a recombinant dna pcdna3 1 addgene 52535 plix 402 addgene 55169 pgex 4t1 addgene 2876 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    91
    Addgene inc recombinant dna pljc5 3xmyc egfp pex26 addgene 139059 pcdna3 flag ha
    Recombinant Dna Pljc5 3xmyc Egfp Pex26 Addgene 139059 Pcdna3 Flag Ha, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+pcdna3+flag+ha/pLJC5-3XMyc-EGFP-PEX26+(Plasmid+%23139059)/pm39695325-376-0-3
    Average 91 stars, based on 1 article reviews
    recombinant dna pljc5 3xmyc egfp pex26 addgene 139059 pcdna3 flag ha - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    93
    Addgene inc addgene pcdna3 flag ha
    Addgene Pcdna3 Flag Ha, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+pcdna3+flag+ha/1477+pcDNA3+flag+HA+Akt1+(Plasmid+%239021)/pm39695325-376-15-15
    Average 93 stars, based on 1 article reviews
    addgene pcdna3 flag ha - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc ha ub addgene
    Ha Ub Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+pcdna3+flag+ha/pcDNA3-Flag-hNF2+(Plasmid+%23107150)/pm39160347-287-25-26
    Average 93 stars, based on 1 article reviews
    ha ub addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    98
    Addgene inc aids reagent program repository rrid addgene 12260 pcdna3 1 flag ubiquitin klaus harbers n a ploc sting ha
    Aids Reagent Program Repository Rrid Addgene 12260 Pcdna3 1 Flag Ubiquitin Klaus Harbers N A Ploc Sting Ha, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+pcdna3+flag+ha/psPAX2+(Plasmid+%2312260)/pm37864791-713-7-12
    Average 98 stars, based on 1 article reviews
    aids reagent program repository rrid addgene 12260 pcdna3 1 flag ubiquitin klaus harbers n a ploc sting ha - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    96
    Addgene inc paper n a pdest cmv flag fanci tony huang20 n a pcdna3 1 ha cul1 yue xiong76 n a pcdna3 1 ha dncul1 yue xiong76 n a ha ubiquitin edward yeh77 addgene
    Paper N A Pdest Cmv Flag Fanci Tony Huang20 N A Pcdna3 1 Ha Cul1 Yue Xiong76 N A Pcdna3 1 Ha Dncul1 Yue Xiong76 N A Ha Ubiquitin Edward Yeh77 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+pcdna3+flag+ha/HA-Ubiquitin+(Plasmid+%2318712)/pm37591242-244-114-131
    Average 96 stars, based on 1 article reviews
    paper n a pdest cmv flag fanci tony huang20 n a pcdna3 1 ha cul1 yue xiong76 n a pcdna3 1 ha dncul1 yue xiong76 n a ha ubiquitin edward yeh77 addgene - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results